rs17170367 chr7:33716784 G>T
- Sequence
tcttggcattcttatgacattcca[G/T]ccagtagagggcaacagttcctac
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 2.16 | -1.83 | 1.00 | |||
| glioblastoma cells | -1.41 | 3.08 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, body mass index (bmi), infant head circumference, triglycerides