rs17170685 chr7:36727078 C>T
- Sequence
aattttgaatcatctcgaaatctg[C/T]tcttgaaaatgagatttcttccct
- ASB in cell types
- SU-DHL-1 (Anaplastic large cell lymphoma) JB6 (Human anaplastic large cell lymphoma)
- ASB for transcription factors
- STAT3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT3_HUMAN | -1.26 | 2.34 | 1.50 | 3.78 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
