rs17171566 chr5:137660608 C>T
- Sequence
gcacctgagaaggctgaagtacgg[C/T]gattcagggaacatttcactgacc
- ASB in cell types
- HEK293 (embryonic kidney) uterus upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.26 | -0.22 | 1.50 | |||
| uterus | 1.92 | -1.61 | 1.00 | |||
| upper lobe of left lung | -0.85 | 1.28 | 1.00 |
Items per page:
1 – 3 of 3