rs17173651 chr7:150898556 G>T
- Sequence
gcaggactctggggcacttggctt[G/T]tcattggctaaaagatgggctggg
- ASB in cell types
- K562 (myelogenous leukemia) EOL-1 (Acute myeloid leukemia) GM02255 (Lymphoblastoid Cell Lines) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.17 | 0.50 | 1.49 | |||
| EOL-1 (Acute myeloid leukemia) | -1.51 | 2.55 | 2.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -0.45 | 0.80 | 1.00 | |||
| neural cell | -0.25 | 0.85 | 1.00 | |||
| thoracic aorta | 1.33 | -1.33 | 1.00 |
Items per page:
1 – 5 of 5