rs17181929 chr10:106799918 C>G
- Sequence
acacaggtcctaaaaggggaattg[C/G]cttctgtcactttattcttcaagt
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.82 | 1.58 | 1.00 |
Items per page:
1 – 1 of 1