rs17187233 chr1:208236360 C>A
- Sequence
acccagcctagccgaggcctttca[C/A]ttttatgaagcaggaaaccacttc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN SUH_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.28 | -1.03 | 2.00 | n/a | No Hit | |||
| SUH_HUMAN | 2.37 | -4.83 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-b, homa-ir, ldl cholesterol, refractive error, serum creatinine, triglycerides