rs17189540 chr13:95256253 A>G
- Sequence
cccggctaagtgagtaggatatta[A/G]ttatttctgcagcccaagttatgc
- ASB in cell types
- HAEC (human aortic endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HAEC (human aortic endothelial cells) | 1.92 | 0.88 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Heart_Atrial_Appendage, Nerve_Tibial