rs17191442 chr15:60507946 A>G
- Sequence
tacctatttaaaacagccaataaa[A/G]agtgagacaacaaatcatgcagtg
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.46 | -0.13 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), major depressive disorder, parkinsons disease, primary rhegmatogenous retinal detachment, prop taste detection threshold