rs17191448 chr11:3815975 A>G
- Sequence
ttggaaacctgcctatgaccctgg[A/G]tacaactctcaggaaggtccctgc
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.58 | -5.27 | 2.00 | 5.16 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), amyotrophic lateral sclerosis (als) age of onset, aortic valve calcium, asthma, hip bone mineral density (bmd), neuroblastoma (brain cancer), parkinsons disease, primary rhegmatogenous retinal detachment, variant creutzfeldt-jakob disease
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood