rs17198114 chr7:134633156 A>C
- Sequence
ctgaccaccagagagcagaccaac[A/C]ttacccttccagaacgagcaaata
- ASB in cell types
- glioblastoma cells MS-1 (Small cell lung carcinoma) neural cell HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -0.82 | 3.48 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | -0.50 | 0.56 | 1.00 | |||
| neural cell | -0.81 | 0.84 | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.40 | -0.77 | 1.00 |
Items per page:
1 – 4 of 4