rs17205498 chr15:62113056 G>A
- Sequence
caggagttaaatgcccgaggacac[G/A]tggttgatgagtgtcagagccagg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.21 | 1.62 | 1.97 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), fasting blood glucose, hdl cholesterol, hdl cholesterol change with statins, homa-b, salmonella-induced pyroptosis, suicide attempts in bipolar disorder (substance abuse/dependence), systolic blood pressure (sbp)