rs17206517 chr7:134826282 G>C
- Sequence
gcttttgaatgtactcacccacga[G/C]cacagctgcccatgaccacaactg
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- TCF21_HUMAN MYOD1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.92 | n/a | 2.00 | -0.27 | Weak Concordant | |||
| MYOD1_HUMAN | 2.32 | 0.64 | 1.00 | -0.17 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP body mass index (bmi), major depressive disorder (broad definition) (males), major depressive disorder (narrow definition) (females), major depressive disorder (narrow definition) (males), recurrent early onset major depressive disorder (males), total cholesterol change with statins, triglycerides change with statins