rs17216803 chr3:56837002 T>C
- Sequence
cagtctgcattacgtaatctttat[T/C]tcaccctcttccagaagacccatt
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ATF2_HUMAN P66A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF2_HUMAN | 3.19 | 1.67 | 1.25 | n/a | No Hit | |||
| P66A_HUMAN | -2.55 | 2.79 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, ldl cholesterol, prop taste detection threshold, total cholesterol change with statins, triglycerides