rs17224926 chr8:130764771 G>A
- Sequence
ccttgccttaggtttgcctagagt[G/A]cggcactggatgggtttctatccc
- ASB in cell types
- HeLa (cervical adenocarcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | 2.03 | -0.53 | 2.75 | |||
| T47D (invasive ductal carcinoma) | 0.39 | 1.01 | 1.06 |
Items per page:
1 – 2 of 2