rs17225114 chr8:13566582 G>T
- Sequence
agatgcatttaggcgggcgtacac[G/T]ttcggatttgtcacaggccaccta
- ASB in cell types
- K562 (myelogenous leukemia) MCF10A (breast epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | n/a | 1.53 | 2.00 | |||
| MCF10A (breast epithelial cells) | -1.56 | 2.14 | 1.00 |
Items per page:
1 – 2 of 2