rs17234657 chr5:40401407 T>G
- Sequence
aaagcatttcctcccagtcacgtt[T/G]tcaaatagcttctcattccctgta
- ASB in cell types
- Th1-cells
- ASB for transcription factors
- TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | -0.74 | 2.17 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, cardiac neonatal lupus, crohns disease, irritible bowel syndrome, stabilized warfarin dose, total cholesterol, ulcerative colitis, years of education
PheWAS abdominal aortic aneurysm, acquired hemolytic anemias, adverse effects of antibacterials (not penicillins), allergies, other, aneurysm of other specified artery, ankylosis of joint, anterior pituitary disorders, aortic aneurysm, aplastic anemia, arteritis nos, atherosclerosis of renal artery, benign neoplasm of uterus, bundle branch block, carbohydrate transport and metabolism disorder, circulatory disease nec, colostomy and enterostomy complication, cystoid macular degeneration of retina, degeneration of intervertebral disc, dermatomycoses, digestive congenital anomalies, disaccharide malabsorption, disorders of fluid, electrolyte, and acid-base balance, disorders of mineral metabolism, diverticulum of esophagus, acquired, elevated prostate specific antigen, first degree av block, generalized anxiety disorder, hyperosmolality and/or hypernatremia, hypertrophy of female genital organs, hypotension, inflammatory conditions of jaw, intracranial hemorrhage, ischemic stroke, mechanical complications of cardiac/vascular device, implant, and graft, menopausal & postmenopausal disorders, mixed hyperlipidemia, neck pain, non-healing surgical wound, occlusion of cerebral arteries, open wound of eye or eyelid, osteoarthritis, localized, osteoarthrosis, localized, primary, osteochondropathies, other aneurysm, other disorders of circulatory system, other disorders of the nervous system, other upper respiratory disease, otitis externa, palpitations, paralysis/spasm of vocal cords or larynx, peripheral or central vertigo, peripheral retinal degenerations, pituitary hyperfunction, postmenopausal atrophic vaginitis, postmenopausal bleeding, precordial pain, premature beats, prostate cancer, pseudomonal pneumonia, restless legs syndrome, reticulosarcoma, retinal hemorrhage/ischemia, schizophrenia, secondary malignancy of bone, sleep related movement disorders, spinal stenosis, spinal stenosis of lumbar region, spondylosis and allied disorders, spondylosis without myelopathy, subdural hemorrhage, subdural hemorrhage (injury), syncope and collapse, systemic lupus erythematosus, thoracic neuritis/radiculitis, torsion dystonia, unspecified erythematous condition, uterine leiomyoma