rs17235708 chr15:33132888 G>A
- Sequence
taatccaacctggagaagtccaga[G/A]gggttgttagtctgtgagcacaca
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) GM18951 (B-cells Lymphoblastoid Cell Lines) GM18526 (B – cells Lymphoblastoid Cell Lines) hepatocytes
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.92 | 0.19 | 1.38 | n/a | n/a |
Items per page:
1 – 1 of 1