rs17235719 chr3:56779115 C>G
- Sequence
ataagcttgatttgcatattctcc[C/G]tgcagctggacatgcagggtcctc
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXP1_HUMAN | -4.17 | 4.41 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, salmonella-induced pyroptosis
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Colon_Transverse, Muscle_Skeletal, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood