rs17236632 chr5:69414843 G>T
- Sequence
tttaacattatctagcacgcactc[G/T]ctgccatgggtccttaagcacagt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.44 | -0.91 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Hypothalamus, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid