rs17239489 chr19:53772987 T>G
- Sequence
tgcaaatgtttcataaactcaaca[T/G]ccagtggtttaagtctcaacaaaa
- ASB in cell types
- K562 (myelogenous leukemia) uterus
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.00 | 0.67 | 2.00 | |||
| uterus | -1.10 | 1.68 | 1.00 |
Items per page:
1 – 2 of 2