rs172431 chr10:32037109 G>A
- Sequence
attattcagctgatatcatcataa[G/A]gcactggcatcagcggttacaaat
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.47 | 1.05 | 1.67 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), homa-b, infant head circumference, ldl cholesterol change with statins, neuroticism, premature ovarian failure, total cholesterol change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Breast_Mammary_Tissue, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Testis, Whole_Blood