rs17245346 chr11:1693417 C>T
- Sequence
tctcggccagcccgggccgcagga[C/T]ctgcagtctcgtttccccaggaat
- ASB in cell types
- neutrophils glioblastoma cells GM17942 (lymphoblastoid cell) tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils | -0.58 | 2.79 | 1.50 | |||
| glioblastoma cells | 0.61 | n/a | 1.50 | |||
| GM17942 (lymphoblastoid cell) | -0.93 | 0.93 | 1.00 | |||
| tibial nerve | -0.55 | 0.78 | 1.00 | |||
| A549 (lung carcinoma) | 0.82 | 0.36 | 2.00 |
Items per page:
1 – 5 of 6