rs17250196 chr7:100219573 G>T
- Sequence
cctgctggcttcccactcccaggg[G/T]ctttctcctccgattccttagctg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.25 | 0.27 | 1.16 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, height, serum dehydroepiandrosterone sulphate (dheas), serum dehydroepiandrosterone sulphate (dheas) (females), serum dehydroepiandrosterone sulphate (dheas) (males)
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Thyroid