rs17251434 chr10:3890339 A>G
- Sequence
agtgaattttgacatcaataagac[A/G]attactcaacttctaaaccctcct
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- ERF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERF_HUMAN | -2.34 | 2.45 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, body mass index (bmi), college completion, hdl cholesterol, hiv-1 disease progression, total cholesterol