rs17254960 chr5:124948560 T>C
- Sequence
ggcctcatacgctgctctggaagc[T/C]tgctgagttagactaaatctgcca
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -1.49 | 1.67 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, hdl cholesterol, infant head circumference, obesity with early age of onset (age >2), salmonella-induced pyroptosis, serum creatinine, variant creutzfeldt-jakob disease