rs17256755 chr16:23325044 C>A
- Sequence
tggcaataaggaaagcaaacacag[C/A]aataagactctgtcaacaagggta
- ASB in cell types
- KerCT (keratenocytes)
- ASB for transcription factors
- ANDR_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.74 | 0.20 | 2.00 | 1.50 | Weak Discordant | |||
| FOXA2_HUMAN | -0.47 | 1.75 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP cognitive response of healthy volunteers to topiramate treatment as measure by the digit symbol cognitive test, diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol