rs17258425 chr1:119744240 A>G
- Sequence
ctccttctgcacttttgtgtggtc[A/G]ttatcctaaagcgccaccagaggg
- ASB in cell types
- CD34+ stem cells-derived erythroblasts DOHH2 (diffuse large B-cell lymphoma) glioblastoma cells upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 3.44 | n/a | 2.00 | |||
| DOHH2 (diffuse large B-cell lymphoma) | 2.09 | -1.36 | 1.00 | |||
| glioblastoma cells | 0.70 | n/a | 1.50 | |||
| upper lobe of left lung | 1.61 | -0.09 | 1.08 |
Items per page:
1 – 4 of 4