rs17259058 chr7:88291962 C>G
- Sequence
ttcccagagatgacagccaagatg[C/G]gtaaagtgatctcacaagggtgtt
- ASB in cell types
- 22RV1 (prostate carcinoma) upper lobe of left lung
- ASB for transcription factors
- ANDR_HUMAN EP300_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 3.27 | -0.32 | 2.33 | n/a | No Hit | |||
| EP300_HUMAN | 3.08 | -3.07 | 1.00 | n/a | n/a | |||
| CREB1_HUMAN | 2.27 | -2.27 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (narrow definition) (females), obesity with early age of onset (age >2)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood