rs17259861 chr1:208608141 G>T
- Sequence
gcatattaatgtctgcaactgttg[G/T]ttgctggactataacacctattgg
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.94 | -1.62 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, hypertension (early onset hypertension), transmission distortion