rs17261138 chrX:119693354 A>C
- Sequence
cgcgccgcttccccctatggccag[A/C]ccagttccagttcttcctgcaacc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HEK293T (embryonic kidney)
- ASB for transcription factors
- PRDM9_HUMAN SKIL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRDM9_HUMAN | -0.31 | 2.73 | 2.00 | n/a | No Hit | |||
| SKIL_HUMAN | 2.71 | -1.91 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Skin_Sun_Exposed_Lower_leg, Thyroid