rs17261452 chr8:121151553 A>G
- Sequence
aaggtagtacccagaatatagatt[A/G]aaactcacatgatgttgagctgac
- ASB in cell types
- LNCaP (prostate carcinoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.22 | 0.89 | 1.18 | |||
| 22RV1 (prostate carcinoma) | 1.64 | -3.59 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, fasting blood glucose, fasting insulin, homa-ir, infant head circumference, irritible bowel syndrome, refractive error, waist hip ratio