rs17270248 chr2:169110002 C>T
- Sequence
gggatcccagtaagcgtcccgcag[C/T]ccctgtttggtcatattggaaagg
- ASB in cell types
- A549 (lung carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.04 | 0.37 | 2.05 | |||
| K562 (myelogenous leukemia) | 0.73 | 0.85 | 1.08 |
Items per page:
1 – 2 of 2