rs17271493 chr15:62124760 C>A
- Sequence
gaggccttgatgctaacagatatt[C/A]ttttagataggtggtcagcaactt
- ASB in cell types
- CFPAC-1(pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CFPAC-1(pancreatic ductal adenocarcinoma) | 0.45 | 1.24 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP crohns disease, hypertension (early onset hypertension), lp-pla2 activity, stabilized warfarin dose, type 2 diabetes