rs17273696 chr16:82738871 G>A
- Sequence
tgaacatgtcttaccatttattct[G/A]ctgcacctacaacccctggtggcc
- ASB in cell types
- H929 (plasma cell myeloma) GM10847 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.41 | 0.21 | 1.52 | n/a | No Hit |
Items per page:
1 – 1 of 1