rs17287575 chr3:42190958 G>C
- Sequence
cggggcttcttctttgggccttca[G/C]atctctatcatcccacccttttca
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -1.81 | 2.20 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, college completion, irritible bowel syndrome, lp-pla2 activity, years of education