rs17289010 chr4:139853530 A>G
- Sequence
gggacattctttagaggctgggtg[A/G]taagaacacaaaagcctcttcagg
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
- ASB for transcription factors
- GATA6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA6_HUMAN | 2.54 | -2.58 | 1.00 | -6.44 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
