rs17290786 chr4:59630508 T>G
- Sequence
aaatccagtatactttcacaagca[T/G]aaccatggcaaatgtccccaaacc
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.29 | -1.15 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), age at death with kuru exposure, birth weight, comorbid depressive syndrome and alcohol dependence, cystatin c in serum, late onset alzheimers disease, pulse pressure, stabilized warfarin dose, systolic blood pressure (sbp), tetrology of fallot