rs17302903 chr16:55509161 G>C
- Sequence
cgcccgcgtagatcgcttcggccg[G/C]gttctacgcccggctcaactatga
- ASB in cell types
- keratinocytes HepG2 (hepatoblastoma)
- ASB for transcription factors
- SNAI2_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | -5.34 | 3.36 | 1.50 | n/a | No Hit | |||
| TYY1_HUMAN | -1.13 | 2.00 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, rheumatoid arthritis, total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Mucosa, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Thyroid