rs17309382 chr19:38014397 C>T
- Sequence
catgagaccagcacagaggaatta[C/T]agaaatgttgaagtcaggacatca
- ASB in cell types
- renal cortex
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.38 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), cognitive response of healthy volunteers to topiramate treatment as measure by the immediate story recall cognitive test, cognitive response to topiramate treatment as measured by the changepc1 (overall cognition) cognitive test, comorbid depressive syndrome and alcohol dependence, ldl cholesterol, tetrology of fallot, transmission distortion