rs17313372 chr8:123058192 A>G
- Sequence
atatttattaaagcagcttggaac[A/G]catctctttgatttttttctgttc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) adipose
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.16 | 0.84 | 1.20 | |||
| K562 (myelogenous leukemia) | -0.07 | 0.79 | 2.05 | |||
| adipose | 2.34 | n/a | 2.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, paternal transmission distortion, rheumatoid arthritis, stabilized warfarin dose, transmission distortion