rs17316431 chr7:24318484 G>T
- Sequence
aagaagtcgccgctcaagttctgg[G/T]gttgttacctcagtcctgcagggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) epithelial cell of prostate PANC1 (pancreatic ductal adenocarcinoma) bipolar neuron
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.79 | 1.95 | 1.45 | n/a | No Hit | |||
| STAG1_HUMAN | -1.75 | 0.86 | 3.33 | n/a | n/a |
Items per page:
1 – 2 of 2