rs17318375 chr8:26513504 G>C
- Sequence
gccaaggcgagtggacaaactgaa[G/C]ctggggtgtccagcgtcttggctg
- ASB in cell types
- neural cell G401 (rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 0.36 | 1.67 | 1.00 | |||
| G401 (rhabdoid tumor of the kidney) | 1.99 | -0.36 | 1.00 |
Items per page:
1 – 2 of 2