rs17324986 chr2:33070335 A>G
- Sequence
catggcaaggtgacggtggcccta[A/G]gtgaagggtaaaataactggggcg
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) MCF7 (Invasive ductal breast carcinoma) breast tumor
- ASB for transcription factors
- ESR1_HUMAN NFIB_HUMAN ERR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.94 | 0.70 | 1.54 | n/a | No Hit | |||
| NFIB_HUMAN | 1.93 | -1.24 | 1.00 | n/a | No Hit | |||
| ERR1_HUMAN | -1.48 | 1.76 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP birth weight, hdl cholesterol, hdl cholesterol change with statins, total cholesterol, triglycerides change with statins