rs17326933 chr2:230160308 G>T
- Sequence
cttgtccttgcaggagctttaata[G/T]ctcaattcctttccgtctctggag
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma) thyroid gland hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.15 | n/a | 2.83 | |||
| A549 (lung carcinoma) | 0.91 | 0.10 | 2.04 | |||
| thyroid gland | 1.48 | -1.14 | 1.00 | |||
| hepatocytes | 1.28 | -0.29 | 1.00 |
Items per page:
1 – 4 of 4