rs17327025 chrX:119728582 T>C
- Sequence
tctggagcaggctttgaggcaagc[T/C]agtttcaaagcagcctagggtggt
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | n/a | 3.76 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Transverse, Testis, Thyroid, Whole_Blood