rs17334729 chr7:36972283 G>C
- Sequence
cttacgggaaggagataacaactc[G/C]tatcctgatgacccatgccatgtc
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.77 | 0.42 | 1.12 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, diabetic nephropathy in type 2 diabetes mellitus - end stage renal disease, fasting insulin, homa-b, homa-ir, parkinsons disease