rs17336789 chr15:81165785 G>A
- Sequence
cagatgccagaagctgaatgactc[G/A]tgttgccttcctactctactggtc
- ASB in cell types
- foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.37 | 2.51 | 2.83 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, hypertension (early onset hypertension), ldl cholesterol, obesity with early age of onset (age >2), salmonella-induced pyroptosis, tardive dyskinesia, tetrology of fallot, triglycerides