rs17349743 chr6:150892075 T>C
- Sequence
gaaacgtgaacctgtgtgcgtttt[T/C]agcagtcaccacatggtggcagcc
- ASB in cell types
- CD34+ stem cells-derived erythroblasts erythroid cells neutrophils from periferal blood heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | n/a | 3.84 | 2.00 | |||
| erythroid cells | 2.29 | n/a | 2.00 | |||
| neutrophils from periferal blood | 2.33 | 0.09 | 1.50 | |||
| heart left ventricle | 1.08 | -1.08 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.27 | 0.41 | 1.00 |
Items per page:
1 – 5 of 5