rs17352536 chr8:74576790 C>G
- Sequence
ttctcatagaacccatgaacacaa[C/G]ttagcaacacaactcatatggcct
- ASB in cell types
- 22RV1 (prostate carcinoma) LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 3.08 | n/a | 2.00 | |||
| LNCaP C4-2B (prostate carcinoma) | -0.97 | 1.48 | 1.00 |
Items per page:
1 – 2 of 2