rs17355543 chr3:58306573 C>T
- Sequence
tctgtacggcgccgcgtagggtct[C/T]ggccgcagaacgtggccgagaggc
- ASB in cell types
- T-cells CD14+ monocytes GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- RAG2_HUMAN STAT1_HUMAN ESR1_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAG2_HUMAN | 2.41 | -2.01 | 1.00 | n/a | n/a | |||
| STAT1_HUMAN | 1.49 | 0.68 | 1.50 | n/a | No Hit | |||
| ESR1_HUMAN | 2.15 | -1.07 | 2.00 | n/a | No Hit | |||
| BRD4_HUMAN | 1.24 | 0.51 | 1.50 | n/a | n/a | |||
| NFAC3_HUMAN | 2.28 | -1.98 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP college completion, height, infant head circumference, ldl cholesterol, rheumatoid arthritis, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Coronary, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid